Explain the difference between the two intaglio processes: etching and engraving.
Solved
Show answers
More tips
- G Goods and services How to Choose the Right Iron: Purchase Tips...
- S Science and Technology Colliders: How They Work and Why They Matter...
- C Construction and repair How to Choose the Best Underfloor Heating?...
- C Computers and Internet How to Get Rid of Windows Genuine Check?...
- C Computers and Internet War of Social Media: Which Platform is the Leader?...
- H Health and Medicine How to Treat the Flu: A Comprehensive Guide...
- O Other What is a Disk Emulsifier and How Does it Work?...
- F Family and Home What does a newborn need?...
- F Family and Home Choosing the Right Car Seat for Your Child: Tips and Recommendations...
- F Food and Cooking How to Get Reconfirmation of Registration?...
Answers on questions: Arts
- M Mathematics Two people are selected at random from a group of 6 pilots and 4 engineers. what is the probability that both of them are engineers?...
- H Health Anybody want to be my Girl friend...
- B Biology Original DNA sequence: 3 TACCGCTTACGTCTGATCGCT 5 Mutated DNA sequence: 3 TACGCGCTTACGTCTGATCGCT 5 Type of mutation ( 3pts): Amino acid ( 3pts): Type of mutation ( 3pts):...
- H Health Smog occurs naturally, so there is nothing you can do to help prevent it. A. True B. False...
Ответ:
engraving is the process or art of engraving a design on a hard surface, especially to make a print.
etching is the art or process of producing etched plates or objects.
Ответ:
I don’t hate u I’m just busy
Explanation: