myapawesomeox22sq
24.03.2020 •
Biology
Describe diseases and disorders associated with a poor diet
Solved
Show answers
More tips
- H Health and Medicine Choosing the Right Contraception Method: Your Ultimate Guide...
- C Computers and Internet How to Choose a Monitor?...
- H Horoscopes, Magic, Divination Where Did Tarot Cards Come From?...
- S Style and Beauty How to Make Your Lips Fuller? Ideas and Tips for Beautiful Lips...
- C Computers and Internet How to Learn to Type Fast?...
- A Art and Culture Who Said The Less We Love a Woman, the More She Likes Us ?...
- F Family and Home How to Get Rid of Your Neighbors?...
- S Society and Politics How Could Nobody Know About the Dead Mountaineers?...
- H Health and Medicine How to Cure Adenoids?...
Answers on questions: Biology
- B Biology contains many wavelengths and is similar to sunlight at noon on a bright day. A. Ultraviolet B. White light C. infrared D. Visible light...
- B Biology PLZZZ HELP 2009 was noted as the first year that more people lived in urban spaces than in rural areas. But in a new study, researchers found that clearing vegetation, or ??...
- B Biology Write a persuasive paragraph that argues either for or against wind energy. Be sure to include both the pros and cons of wind energy in your paragraph. Use all data, evidence...
- B Biology What are sign and symptoms of alzheimer’s disease...
- B Biology Most amphibians have an aquatic larval form with and a terrestrial adult form with...
- B Biology Explain why the answer choice is right for both of the questions if you can...
- B Biology Fill in the corresponding mrna sequence of the dna strand: atgcgctgcacgtgcacgtt tacgcgacgtgcacgtgcaa...
- B Biology What is the meaning of life?...
- B Biology PEePeEpEe in the b00ty h0le...
- B Biology What type of isolation was occurring in the collared lizard population?...
Ответ:
Among these diseases are the chronic diseases, such as: obesity, heart diseases, diabetes, blood pressure, tooth decay, thinness, anemia and osteoporosis. The underlying cause of all such diseases is pursuing bad dietary habits, like eating fatty foods, using saturated fats and fast foods, just to mention some.
Explanation:
About half of all American adults have one or more preventable chronic diseases, many of which are related to poor quality eating patterns and physical inactivity. These include cardiovascular disease, high blood pressure, type 2 diabetes, some cancers, and poor bone health.
Ответ: