![anthonyfr10004](/avatars/17392.jpg)
anthonyfr10004
31.08.2019 •
Biology
During heart development which of the following represent the correct temporal events in morphogenesis?
a. formation of the linear heart tube, formation of second heart field, septation, and looping.
b. formation of heart primordia, formation of the linear heart tube, looping, and septation
c. septation, looping, and formation of second heart field.
d. formation of second heart field, septation, specification of the cardiogenic mesoderm.
Solved
Show answers
More tips
- F Family and Home Tender Care for Your Parquet: Is it Possible to Clean Parquet?...
- S Society and Politics Is It Fact or Fiction? Let s Talk About Anton Chekhov s Pseudonym...
- S Sport Playing Bowling: Rules and Advice for Novices...
- C Computers and Internet How to Properly Repartition a Hard Drive?...
- A Auto and Moto What Is the Cost of Customs Clearance for a Car in Russia?...
- L Leisure and Entertainment Should You Buy a Ceramic Knife?...
- C Computers and Internet How to easily and quickly disable Firebug in Gmail and Google Docs...
- G Goods and services How to sew a ribbon: Tips for beginners...
- F Food and Cooking How to Make Mayonnaise at Home? Secrets of Homemade Mayonnaise...
- C Computers and Internet Which Phone is Best for Internet Surfing?...
Answers on questions: Biology
- B Biology Scientists have found fossils of the same species of lizard in the same rock layers on the east coast of South America and the west coast of Africa. How would supporters...
- B Biology 1) If a messenger RNA has the sequence: 5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3 a) What is the corresponding sequence of the coding strand (DNA)? b) What is the corresponding...
- B Biology Genes that work together to produce a third trait...
- B Biology Gametes differ from other cells in the body because gametes A. have three copies of every gene. B. live forever. C. are only inherited from the mother. D. are haploid....
- B Biology 1. Click Create alien and create your own alien. Describe its traitsin the Parent row of the table:...
- B Biology Compare and contrast mendelian inheritance with incomplete dominance...
- B Biology How do the interactions of the organelles (mitochondria, nucleus, ribosomes, rough ER, smooth ER, Golgi, cytoskeleton, nucleolus, plasma membrane, cytoplasm, etc) affect...
- B Biology 1. What is the approximate size of the largest per-person footprint? How does this compare to the smallest? (To answer, estimate the two numbers, then divide the larger...
- M Mathematics Marcus has a total of 10 nickels and dimes in his pocket. he has a total of 70 cents. how many dimes does he have in his pocket?...
- S Social Studies John is a school prefect. he finds his best friend, who is also the head prefect, breaking a school rule. john says that he was sorry that he has to book him (his best...
Ответ:
The correct answer is option B.
Explanation:
A biological procedure, which makes an organism to form its shape is known as morphogenesis. It is one of the basic features of developmental biology along with the control of cellular differentiation and cell growth. The procedure monitors the organized spatial arrangement of cells at the time of the embryonic development of an organism.
During the development of heart, the formation of heart primordia takes place during the first trimester of pregnancy, after that the formation of endothelial heart tubes takes place, then looping, and in the end septation occurs.
Ответ:
You can say science is evidence. Electric works because there are positive and negative charges. We have children because a woman has eggs and a man fertilizes them and that put together you’d get a baby. We use science everyday even when you don’t realize it.