Given that the sequence of nucleotides in a DNA strand will be used to produce an mRNA strand that will then code for a protein, mutations in the DNA can affect the final product. Depending on the severity of the mutation, the protein can range from not being affected to being rendered completely nonfunctional, especially if the reading frame is altered. Which of the following represents a change in reading frame if the template strand of DNA reads as follows?
A) AGCTGGACTTTAGACAAG
B) AGCTGGACTTTAGACAAG
C) AGCTGGACTTGAGTGAACAAG
D) AGCTGGACTATAGACAAG
E) AGCUGGACUUUAGACAAG
F) AGCTGCGACTTTAGACAAG
Solved
Show answers
More tips
- A Auto and Moto Mastering One-Movement Parking: All You Need to Know...
- P Photography and Videography Understanding HDR: How It Works and Why You Need It...
- P Photography and Videography How to Choose the Perfect Photo Paper for Your Images?...
- C Computers and Internet How to Choose an Uninterruptible Power Supply (UPS) for Your Computer: Expert Tips...
- S Science and Technology How to choose a home theater system?...
- A Auto and Moto How to Choose a Car Wash? Tips and Recommendations...
- A Animals and plants How ants survive winter: exploring the secrets of their winter life...
- C Construction and repair How to Choose the Best Underfloor Heating?...
- S Sport When is the Champions League final?...
- S Sport When and Where Will the 2014 World Cup be Held?...
Answers on questions: Biology
- B Biology Name and explain all of the stages of the nitrogen cycle...
- B Biology Can anyone compare and contrast human body systems and elephant body systems? I need 2-3 for comparing and 2-3 sentences for contrasting....
- B Biology Can someone help me with this? 1. - This is the ground layer made up of tree roots, soil and decaying matter. 2. - The lower layer of plants and shrubs in a forest...
- B Biology Why does alpha Centauri appear to be yellow-white?...
- B Biology In some pedigrees, such as this one, the generations are not numbered, only individuals. How can individual 7 be unafflicted when both of his parents are afflicted?...
- B Biology What is the main function of the structure that is identified as stemIt anchors the plant.It produces food.It absorbs nutrients.It supports the plant.Mark this and...
- B Biology about the same time that infants begin to crawl, usually between 6 and 8 months, they also begin to show separation anxiety. this indicates that they...
- B Biology Abasketball player has fallen on the tip of his elbow. immediate isolated swelling appears over the apex of the elbow. what condition should be suspected...
- B Biology Aterm for excessive secretion and discharge of urine is:...
- B Biology Amedical experiment is planned to compare the herb echinacea with a placebo for preventing colds. one response variable will be volume of nasal secretions (if you have...
Ответ:
AGCTGCGACTTTAGACAAG
Explanation:
The response is AGCTGCGACTTTAGACAAG because this mutation has a number of nucleotides that is not multiple of three bases for codon, which is required for the synthesis of amino acids. In consequence, this mutation will change the reading frame in which ribosome reads the sequence of the mRNA
Ответ:
A
Explanation:
The question uses words such as next and finally. This indicates that it is a sequence of events.