![kikirogers3882](/avatars/20994.jpg)
kikirogers3882
30.01.2020 •
Biology
Imagine that a brown horse and a whitehorse cross to produce an offspring whosecoat is made up of some brown hairs and somewhite hairs. which pattern of dominance is thisan example of?
Solved
Show answers
More tips
- H Health and Medicine How to Cure Adenoids?...
- H Health and Medicine Why Wearing a Back Brace Can Be Beneficial During Back Strain?...
- S Sport When and Where Will the 2014 World Cup be Held?...
- C Computers and Internet How to Choose a Monitor?...
- H Horoscopes, Magic, Divination Where Did Tarot Cards Come From?...
- S Style and Beauty How to Make Your Lips Fuller? Ideas and Tips for Beautiful Lips...
- C Computers and Internet How to Learn to Type Fast?...
- A Art and Culture Who Said The Less We Love a Woman, the More She Likes Us ?...
Answers on questions: Biology
- B Biology MUTATED DNA DNA: CTGGGAACCTAATATCGC mRNA: Amino acids TYPE OF MUTATION AND ITS EFFECTS Can someone help as soon as possible pls???...
- B Biology Which of the following do plant cells have, but animal cells do not have?...
- B Biology MUTATED DNA DNA: ACAGGTTAATATGGCCAGTAC mRNA: Amino acids TYPE OF MUTATION AND ITS EFFECTS I need to find the mRNA and amino acids for mutated DNA and also the type of mutation...
- B Biology Scientific method review crossword answers...
- B Biology Weather patterns on Earth may be...
- B Biology Where is neuronal convergence least to occur in the retina...
- B Biology Tell Me About The Uses Of Condom in sex and why condom are used???...
- B Biology Based on the diagram, select the correct answer from each drop-down menu. hawk snake mongoose lizard grasshopper cricket green plants If an ecological pyramid showed these organisms,...
- B Biology I need help on 3 and 4 please :(...
- H Health 2. Find the missing terms: (x+_) (3x+_)=3x² +27x +24)a. 6,4b. 4.6c. 8,3d. 12,2...
Ответ:
Because in the codominance, both the traits of the brown hair and white hair is expressed. So it carries both the traits, regardless of whether it is recessive or dominant.
Hope this helps :)
Ответ:
Organisms ingest large molecules, like carbohydrates, proteins, and fats, and convert them into smaller molecules like carbon dioxide and water. This process is called cellular respiration, a form of catabolism, and makes energy available for the cell to use.
Explanation: