Which forms of transport across a cell membrane do NOT require the use of ATP?
Solved
Show answers
More tips
- C Computers and Internet Keep Your Mouse Pad Clean: The Right Way to Clean It?...
- F Food and Cooking Homemade French Fries: The Ultimate Guide...
- D Dating, Love, Relationships How Long Can Love Last?...
- A Auto and Moto Mastering One-Movement Parking: All You Need to Know...
- C Computers and Internet How to Properly Order Clothing from International Online Stores...
- H Health and Medicine Headache: A Comprehensive Guide to Treatment...
- F Family and Home How to Choose the Best Diapers for Your Baby?...
- A Auto and Moto Discovering the Leader: What is the Most Expensive Car in the World?...
- F Food and Cooking How to Quickly Put your Child to Sleep?...
- C Computers and Internet How to Create a Website for Free and Easy?...
Answers on questions: Biology
- B Biology 7. In comparing hydrochloric acid (pH 1) and sodium hydroxide (pH 13), is one more dangerous than the other? Why or why not?...
- B Biology ASAP PLEAS HELP Do you think virtual autopsies will ever replace regular autopsies? Why or why not?...
- B Biology Sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT...
- B Biology Given the sequence of dna nucleotide base tagtagtag give the complementary stand of mrna produced during transcription...
- B Biology Suppose there a crime scene where an adult male, adult female, and a younger child are all found deceased. investigators at the scene wonder if the child is the offspring the...
- B Biology Why is sunlight on the left side of the photosynthesis equation...
- B Biology Which activity ends when the final codons dictate a stop signal? a. replication. b. transcription. c. regulation. d. translation.?...
- B Biology Can someone help explain please...
- B Biology can any1 of u guys send me a table of food test? and what s the result of it? (positive and negative)...
- M Mathematics What is an example of an negative rational number that is not an integer?...
Ответ:
so they don't die, in a way it's food for plants