![lksocossiodks1219](/avatars/49757.jpg)
lksocossiodks1219
27.05.2020 •
Biology
Which important event in Earth's history occurred during the Juragale perled?
Solved
Show answers
More tips
- H Health and Medicine Is Massage Necessary? Facts and Opinions...
- C Computers and Internet Clearing Cache: How to Speed Up Your Browser...
- S Style and Beauty How are artificial nails removed?...
- S Style and Beauty Secrets of Tying a Pareo: 5 Ways...
- F Food and Cooking Everything You Need to Know About Pasta...
- C Computers and Internet How to Choose a Monitor?...
- H Horoscopes, Magic, Divination Where Did Tarot Cards Come From?...
- S Style and Beauty How to Make Your Lips Fuller? Ideas and Tips for Beautiful Lips...
Answers on questions: Biology
- B Biology Will give BRAINLIEST How are animals affected by succession?...
- B Biology what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACCGTAACCACAACT and TACCTGTTAAGCTACTT?...
- B Biology Why do plants put so many nutrients in fruit when the fruit does not provide nutrients to the growing seed?...
- B Biology What is 18,000 expressed in scientific notation? 1.8 × 10–4 1.8 × 104 1.8 × 10–5 1.8 × 105...
- B Biology List the producers in a food web...
- B Biology A dichotomous key is used to and you always start with ? Help you find your way through an unknown area; #1 Help you identify an unknown organism; #2 Help you solve a riddle;...
- B Biology What is the main purpose of the Organization of Petroleum Exporting Countries (OPEC$...
- A Arts Rate this song for me 1/10 Heart-giggle is where we start Five miles and poles apart Where worlds collide and days are dark You may have my apple, you can take my teddy...
- M Mathematics given quadrilateral ABCD side AB has a slope of -2/3 and side BC has a slope of 7/2. If ABCD is a parallelogram then what is the slope of AD?...
- M Mathematics Given OABCD, solve for x....
Ответ: