![johnnydenali67](/avatars/43646.jpg)
johnnydenali67
04.07.2019 •
English
What directive does the host give the travelers at the end of the prologue from the canterbury tales?
Solved
Show answers
More tips
- H Health and Medicine What Are the Best Vitamins? A Scientific View on Vitamin Supplements...
- F Food and Cooking From Latte to Espresso: Which Coffee Drink is the Most Popular on Earth?...
- C Computers and Internet How to Set Up Internet on iPhone? Detailed Guide with Step-by-Step Instructions...
- P Philosophy 8 привычек, чтобы достичь счастливой жизни...
- F Food and Cooking How Many Grams Are In a Tablespoon?...
- G Goods and services How to Choose the Right Iron: Purchase Tips...
- S Style and Beauty How to Choose the Perfect Hair Straightener?...
- H Health and Medicine How to Choose the Right Glasses?...
- H Health and Medicine What vaccines do children need?...
- H Health and Medicine AKDS Vaccination: Ensure Your Child s Safety...
Answers on questions: English
- E English Read the passage. The Peasant was in trouble. Her aged timbers groaned and shrleked as she plunged from the wave crests into the troughs. The wind rose; spray froze...
- E English V. Supply the correct form of the words in brackets. 1. People in my country are very warm and . (FRIEND) 2. An is a child whose parents are dead. (ORPHANAGE) 3....
- B Biology The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from...
- M Mathematics There are 53% monkeys, 28% wolves 16% elephants and the renaming 6 are bears. How many animals are in the zoo?...
- B Biology Explain which student most likely lives in a highly developed country. Describe how one of the four categories of ecological footprint can serve as an environmental...
- H History What specific factors created a climate favorable to the reform efforts of the progressive era?...
Ответ:
At the end of the Prologue from The Canterbury Tales, the Host proposes each of the travelers to tell two stories on their way to Canterbury and two more on their way back, so that the journey is more enjoyable.
The host will ride with them and will be their judge and guide. The man who tells the best story will be given a supper in the host's tavern, paid by the rest of them. The man who draws the shortest cut shall begin telling the first story.
Ответ:
I LIKE THAT GAME
Explanation: