nativebabydoll35
04.06.2020 •
Mathematics
display the data in a dot plot. Identify any clusters, peaks , or gaps in the data to support your answer.
Solved
Show answers
More tips
- S Sport Playing Bowling: Rules and Advice for Novices...
- C Computers and Internet How to Properly Repartition a Hard Drive?...
- A Auto and Moto What Is the Cost of Customs Clearance for a Car in Russia?...
- L Leisure and Entertainment Should You Buy a Ceramic Knife?...
- C Computers and Internet How to easily and quickly disable Firebug in Gmail and Google Docs...
- G Goods and services How to sew a ribbon: Tips for beginners...
- F Food and Cooking How to Make Mayonnaise at Home? Secrets of Homemade Mayonnaise...
- C Computers and Internet Which Phone is Best for Internet Surfing?...
- F Food and Cooking Everything You Need to Know About Pasta...
- C Computers and Internet How to Choose a Monitor?...
Answers on questions: Mathematics
- A Arts Explain why a work of art is considered so valuable and who is affected when a work of art is stolen...
- M Mathematics Question 8 (1 point) A company laid off 80% of its work force. The number of employees after the layoff is 400. How many employees were there before the layoff? 15,000 Oь O...
- M Mathematics How you get the transform i from A B C D i don t get it...
- B Biology What is the mRNA in TACCGGATGCCAGATCAAATC?...
Ответ:
Step-by-step explanation:
let's turn the denominators of 2/3 and 1/5 the same
10/15 and 3/15
now add them
13/15
to make it 15/15 we need 2/15
so it is option B