sascsl7973
04.06.2021 •
Mathematics
Write a formula that will help you determine
your total cost.
Let's let
t = cost of ticket
f = cost of food
b = cost of bus (one way)
C = total cost
Your friend asks you to go to the
amusement park for a day. You'd like to
go, but you need to find the total cost.
You'll need to pay for a ticket and food,
plus bus fare to get to the park and
back. (Remember, you'll need to take
the bus to the amusement park and
home, so you'll need to double the cost
of the ticket.)
Enter the correct answer.
DOU
DONE
Cle all
DOO
Solved
Show answers
More tips
- F Food and Cooking Which Calamari Salad is the Most Delicious?...
- S Style and Beauty How are artificial nails removed?...
- S Style and Beauty Secrets of Tying a Pareo: 5 Ways...
- F Food and Cooking Everything You Need to Know About Pasta...
- C Computers and Internet How to Choose a Monitor?...
- H Horoscopes, Magic, Divination Where Did Tarot Cards Come From?...
- S Style and Beauty How to Make Your Lips Fuller? Ideas and Tips for Beautiful Lips...
- C Computers and Internet How to Learn to Type Fast?...
Answers on questions: Mathematics
- M Mathematics Compute the value of ∑ 8 =1 , where is the same sequence as in the previous question....
- M Mathematics I would like to drop out of school. It s too stressful! At home, I have to take care of my 3-year-old sister and do my chores on top of that take care of my dogs then go to Cross...
- M Mathematics If the diameter of a circle is 25 inches, how long is the radius?...
- B Biology Ineed to perform rna transcription and translation on this strand of dna, given that the mrna is the opposite of this dna strand (whatever that means): tacacccgatgcgctcgaagtatgctagatcgatgcgtcaccgtcgtccgtagtgtagctagcgtaatci...
- E English Twice two are four correct the sentence...
- C Chemistry Based on what you have learned about intermolecular forces, would you say that matter is fundamentally attracted or repulsed by other matter?...
Ответ:
any value for t can make this true.
Step-by-step explanation:
Plz mark me brainliest!
It's ok if u don't...lol
I hope this helped!!