![smuqtadir124](/avatars/29048.jpg)
smuqtadir124
29.11.2019 •
Biology
4. you and your family are driving through an apple orchard. you notice that the trees in the orchard have both red and yellow ripened apples on the same tree. how is this possible? explain the process.
Solved
Show answers
More tips
- S Sport How to Do Push-ups Correctly?...
- S Style and Beauty How to Grow Hair Faster: Real Methods and Advice...
- F Family and Home How to Remove Fading from Clothes: Tips and Tricks...
- F Food and Cooking How to Make Polendwitsa at Home?...
- F Family and Home Parents or Environment: Who Has the Most Influence on a Child s Upbringing?...
- P Philosophy Unbelievable stories of encounters with otherworldly forces...
- L Leisure and Entertainment How to Choose the Perfect Gift for Men on February 23rd?...
- H Health and Medicine How to Treat Whooping Cough in Children?...
- H Health and Medicine Simple Ways to Lower Cholesterol in the Blood: Tips and Tricks...
- O Other How to Choose the Best Answer to Your Question on The Grand Question ?...
Answers on questions: Biology
- B Biology What is the mRNA in TACCGGATGCCAGATCAAATC?...
- B Biology In a species of fish, fin shape is controlled by a single gene that has only two alleles. In a generation of 185 fish, the frequency of the recessive allele is 0.25....
- M Mathematics if a plane can travel 500 miles per hour with wind and 400 miles per hour against the wind find the speed of the plane with out a wind and speed of the wind....
- M Mathematics Please help find the commission!...
- M Mathematics A farm stand sells apples, a, for $5 a bucket and peaches, p, for $8 a bucket. The stand earned $155 in revenue last month. The stand sold 5 fewer peach buckets than...
Ответ:
Ответ:
71%
Explanation: In simplest terms, water makes up about 71% of the Earth’s surface, while the other 29% consists of continents and islands. To break the numbers down, 96.5% of all the Earth’s water is contained within the oceans as salt water, while the remaining 3.5% is freshwater lakes and frozen water locked up in glaciers and the polar ice caps.
Hope this helps you out ;P