Acertain segment of dna can be used as a molecular clock. its rate of mutation is one mutation per 20 million years. examine the dna segments from two different species:

species a: gtacctaagttcaccgaatt
species b: gaacctaagggcaccgaact

using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.

Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied by the rate of mutations

Google defines it as:

"a region of the forebrain below the thalamus which coordinates both the autonomic nervous system and the activity of the pituitary, controlling body temperature, thirst, hunger, and other homeostatic systems, and involved in sleep and emotional activity."

basically, its a part of the brain below the thalamus and it controls your homeostatic systems. it also helps decide if you're gonna get good sleep and how you feel