nellyjsotelo
31.07.2019 •
Biology
Awoman has come to the clinic for her first prenatal visit. which method would be the most effective way for the nurse to initiate data gathering for a health history
Solved
Show answers
More tips
- F Family and Home How to Remove Fading from Clothes: Tips and Tricks...
- F Family and Home How to Remove Tar Stains: Tips and Recommendations from Experts...
- L Leisure and Entertainment How to Learn to Draw Graffiti: Tips for Beginners...
- G Goods and services How to sew a ribbon: Tips for beginners...
- L Leisure and Entertainment How to Land on the Moon: Your Comprehensive Guide...
- H Health and Medicine Novomin: What is it and how to use it?...
- A Art and Culture Attention, the Final Episode of Margo is Almost Here!...
- A Art and Culture How to Learn Screaming: Step-by-Step Guide for Beginners...
- D Dating, Love, Relationships 10 Useful Tips on How to Survive a Breakup?...
- S Style and Beauty How to Break in New Shoes: 7 Simple Methods...
Answers on questions: Biology
- B Biology Match the genes with their linkage ability....
- B Biology Normal hemoglobin dna - cacgtggactgaggactcctc what is the normal hemoglodin acid- normal hemoglobin a.a sequnce for figuring out rna a binds with u c binds with g...
- B Biology Which step happens first in dna replication? a. protein is formed from the dna. b. base pairs are broken apart. c. the replication fork forms. d. the dna is checked...
- B Biology Pl find mrna and a.a sequnce to this sickle cell hemoglobin dna- cacgtggactgaggacacctc sickle cells hemglobin mrna- sickle cell shemoglobin a.a sequnce-...
- B Biology Kevin decides to find out which fertilizer is best for tomatoes. he pots up three plants, all with the same soil, giving one no fertilizer, giving the second type a...
- B Biology Which sentence about protists is accurate? all protists are unicellular and microscopic in nature. they have organelles, so protists are eukaryotic in nature. all protists...
- B Biology Which of the following populations is more likely to reach hardy–weinberg equilibrium? large population residing on an isolated island small population, reproductively...
- B Biology Asap! how do most silicate materials form?...
- B Biology Summarize The Procedure What methods are you using to test this hypothesis? Outline the steps of the procedure in full sentences. Ecological Succession Lab Report...
- B Biology What trend do you see with the temperature of the universe and the formation of the galaxies , stars , and planets ?...
Ответ:
The effective method is to conduct an interview in a private room to obtain her health history. By conducting interview it will help to know her conditions and also her personal and health history, it is also a one on one talk for the nurse and the client.
Ответ:
The answer is b.
Explanation:
The villi helps increase the absorption surface of the small intestine. It makes sure every nutrient is absorbed b4 going 2 the lg. intestine..