NawnyMonster
31.03.2020 •
Biology
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?
a. Normal gene: ATGGCCGGCCCGAAAGAGACC
b. Mutated gene: ATGGCCGGCACCGAAAGAGACC
c. Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
d. Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
Solved
Show answers
More tips
- W Work and Career Secrets of Punctuality: How to Learn to Never Be Late?...
- L Leisure and Entertainment How to Choose the Perfect Gift for Men on February 23rd?...
- H Health and Medicine How to Treat Whooping Cough in Children?...
- H Health and Medicine Simple Ways to Lower Cholesterol in the Blood: Tips and Tricks...
- O Other How to Choose the Best Answer to Your Question on The Grand Question ?...
- L Leisure and Entertainment History of International Women s Day: When Did the Celebration of March 8th Begin?...
- S Style and Beauty Intimate Haircut: The Reasons, Popularity, and Risks...
- A Art and Culture When Will Eurovision 2011 Take Place?...
- S Style and Beauty How to Choose the Perfect Hair Straightener?...
- F Family and Home Why Having Pets at Home is Good for Your Health...
Answers on questions: Biology
- B Biology What is the over view of : diffusion across a semipermeable membrane ?...
- B Biology a small,leafy branch is cut from the tree. After some hours,the stem of the branch remains firm,but the leaves become limp,suggest an explanation for this.stem remains firm and leaves...
- B Biology What are some ways that the nitrogen cycle overlaps with or influences the oxygen and carbon cycles? Are any of these interactions between the cycles positive?...
- B Biology What process is applied to identify mutations or errors in dna molecules...
- B Biology If heart rates is 76 beats per minute how many times the heart beat in a day...
- B Biology How do the Himalayan tahrs living in the Himalaya Mountains and the mountain goats living in Yellowstone National Park compare?...
- B Biology Regions of the body which require large surface area for absorption, such as the cells covering the inner surface of the small intestine, often have...
- B Biology hello varshaa sismein dushare I d kholi hu toh first I d kaha gaya sisbatayo na pls☹️☹️☹️☹️☹️☹️☹️☹️☹️☹️☹️...
- B Biology 7 The low temperatures in Colton for 5 consecutive days were -8°F, -13°F, - 4 F, -9°F, and -16°F. What was the average low temperature for the 5 days? (do not label your answer) 10...
- B Biology In transcription what molecules and cell organelles are involved...
Ответ:
Base addition-missense
Explanation:
Missense mutations or non-synonymous mutations are types of point mutations where a single nucleotide is changed to cause substitution of a different amino acid. This in turn can render the resulting protein nonfunctional.
Ответ:
Hope this helps! ^-^