Dragonskeld
22.11.2020 •
Biology
Can someone please help me
Solved
Show answers
More tips
- C Computers and Internet Dynamically Assigned IP Address: What Is It and How Does It Work?...
- H Health and Medicine Angina: Causes, Symptoms, and Treatment...
- C Computers and Internet How to Learn to Type Fast?...
- F Food and Cooking Delight for Gourmets: How to Prepare Liver Pate...
- S Style and Beauty How to braid friendship bracelets?...
- H Health and Medicine Mercury Thermometer Danger: What to do when a thermometer breaks?...
- F Food and Cooking Which Calamari Salad is the Most Delicious?...
- S Society and Politics 10 Tips for Boosting Your Self-Esteem...
- F Food and Cooking The Most Delicious and Simple Fish in Batter Recipe...
- H Health and Medicine What is Autism? Understanding the Basics of This Neurodevelopmental Disorder...
Answers on questions: Biology
- B Biology 5. How long does an Earth-size planet take to form from a 1km diameter rock?...
- B Biology Which plant would have an advantage in getting pollinated? choices are: A plant with a long stalk to hold the flower above the others? A plant with a short stalk because it...
- B Biology Which of these is an example of pathogen transfer via indirect contact? a. kissing b. handshaking c. sexual intercourse d. breathing infected air...
- B Biology A hair found at the scene of a crime is long, straight, and uniform in color. The scale are flat and narrow and the cross-section of the hair is circular. Which is the most...
- B Biology What is the mRNA in TACCGGATGCCAGATCAAATC?...
- B Biology E. coli is a pathogen that can be transmitted when you eat raw or undercooked food. What type of transmission is this? A. Vector B. Animal C. Vertical D. Horizontal...
- B Biology Which estuarine zone is conducive to the growth of mangrove forests? a. oligohaline b. mesohaline c. polyhaline d. euhaline e. stenohaline...
- B Biology Which kind of volcano is mostly likely to form from this plate movement? a. trench volcano b. composite volcano c. shield volcano d. cinder cone volcano...
- B Biology Evolution never occurs in a straight line. there are always branches and nodes that can be seen along the way. based on the image, which two statements are true?...
- B Biology During reflection, waves are sent a. into atmosphere b. in several directions at once c. in a direction parallel to the tide d. in the direction from which they came...
Ответ:
As a result the atmospheric concentration has increased by about 13 per cent. The carbon dioxide theory predicts that such an increase should raise the average temperature of the earth one degree F