Channels allow the appropriate ions or small molecules to pass through.
(a) true
(b) false
Solved
Show answers
More tips
- S Society and Politics What If There s War Tomorrow, What If We Go to War?...
- S Sport How to Do a Jumping Split...
- A Animals and plants What Do Terriers Eat?...
- F Food and Cooking Discover the Benefits and Properties of Dates...
- C Computers and Internet Dynamically Assigned IP Address: What Is It and How Does It Work?...
- S Style and Beauty How to Get Rid of Acne: Scientifically Proven Methods...
- H Health and Medicine Simple Ways to Lower Cholesterol in the Blood: Tips and Tricks...
- O Other How to Choose the Best Answer to Your Question on The Grand Question ?...
- L Leisure and Entertainment History of International Women s Day: When Did the Celebration of March 8th Begin?...
- S Style and Beauty Intimate Haircut: The Reasons, Popularity, and Risks...
Answers on questions: Biology
- B Biology Which of the following is a living factor in the environment?...
- B Biology The greater the amount of weight pressing on an object: the less the amount of pressure. the less the amount of gravity pulling on the object. the greater the amount...
- B Biology Choose three of the following organs. Research the types of cells that make up the organ. Describe in detail the location of the organs and the locations of the cells....
- B Biology 12. Observe phototaxis“ (the movement of organisms toward light) in the culture of Euglena on the distribution of the organisms, and return the cover to its exact...
- B Biology 5. Why do scientists publish the results of their work? -to verify their results -to get credit for a theory -to form a be hypothesis -to analyze data...
- B Biology Что нужно сделать для повышения устойчивости древесины к вредному воздействиям?...
- B Biology A bird is an organism. Many birds on the same tree are a that tree are a The birds, insects, and squirrels in O community / population O organism / community O population...
- B Biology New technologies could improve conditions for all societies. However, priorities are different in different parts of the world. Which is the least important goal of...
- B Biology This is because ions move from an area of concentration to an area of concentration....
- B Biology AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino...
Ответ:
The given statement is true.
Explanation:
A channel protein refers to a protein, which permits the conduction of particular substances like small molecules or ions through the cell membrane. They perform this task either through the process of active transport or facilitated diffusion on the basis of the concentration gradient or due to the variation in the concentration of components outside and within the cell membrane.
Ответ:
rdgcdyitceyhifcr57853wdvi