andybiersack154
11.04.2021 •
Biology
Completa las siguientes hebras de ADN
5' ATCGTACGTAGCTACGTAGCT 3'
5' GGTATTACGGGCTTAGGCGCCCAA 3'
5' AATTCGGGATTCCATTGCTGAC 3'
Solved
Show answers
More tips
- A Animals and plants How ants survive winter: exploring the secrets of their winter life...
- F Food and Cooking Discover How to Properly Prepare Dough for Rasstegai...
- P Philosophy Unidentified Flying Object - What is the Nature of this Phenomenon?...
- F Family and Home Protect Your Home or Apartment from Pesky Ants...
- O Other What is a Disk Emulsifier and How Does it Work?...
- F Family and Home What does a newborn need?...
- F Family and Home Choosing the Right Car Seat for Your Child: Tips and Recommendations...
- F Food and Cooking How to Get Reconfirmation of Registration?...
- C Computers and Internet How to Get Rid of Spam in ICQ?...
- A Art and Culture Who Said The Less We Love a Woman, the More She Likes Us ?...
Answers on questions: Biology
- B Biology Will give crown! 1. Predict: How do you expect the spread of a foodborne disease to be similar to and different from the spread of a person-to-person disease? 2. How are foodborne...
- B Biology In a porphyritic volcanic igneous rock, what are the large- grained crystals called? phenocrysts vesicles Previous...
- B Biology CRISPR-Cas9 is a genetic modification technique that edits parts of the genome of an organism. Using this technique scientists can add, remove, or modify sections of the DNA sequence....
- B Biology When graham sees without awareness, he uses: the frontal lobes. the visual cortex. a primitive visual pathway. the temporal lobes?...
- B Biology What is a hypertonic extracellular solution...
- B Biology Can anyone me? i think it’s c but idk...
- B Biology PLEASE HELP! Brainlest to first correct answer. (blank) means to be composed of one cell.(blank) means to be composed of many cells....
- B Biology If the basement membrane was damaged, do you think new epithelial tissue could grow?...
- B Biology Is the population of mice different in figure 3 than in figure 1? Explain why....
- B Biology Traits that improve an organism chance for survival...
Ответ:
yes.
Explanation:
hdjsbsjwhsjbsjwbsjsjs
Ответ:
a part water and steam
b part steam
c part magnets
d part turbine
thanks