Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Solved
Show answers
More tips
- C Computers and Internet How Do You Refill Cartridges?...
- F Family and Home How to Keep Your Home Warm: Tips and Tricks...
- D Dating, Love, Relationships Does a Person s Character Depend on the Color of Their Eyes?...
- O Other Childhood Fears: What Many of Us Experienced...
- H Health and Medicine Simple and Effective: How to Get Rid of Cracked Heels...
- O Other How to Choose the Best Answer to Your Question on The Grand Question ?...
- L Leisure and Entertainment History of International Women s Day: When Did the Celebration of March 8th Begin?...
- S Style and Beauty Intimate Haircut: The Reasons, Popularity, and Risks...
- A Art and Culture When Will Eurovision 2011 Take Place?...
- S Style and Beauty How to Choose the Perfect Hair Straightener?...
Answers on questions: Biology
- B Biology What biological macromolecule is made up of monomers like the one shown below? A. Lipid B. Nucleic acid C. Protein D. Carbohydrate...
- H History How can scientists study mars if they can’t directly observe what is happening there?...
- E English A + A = 50B + B = 47C + C = 78A + B x C =...
- B Biology Question 1 • In a food chain, the organism that eats the secondary consumer is the: • A. Carnivore •B. Second consumer •C. Primary consumer • D. Producer...
- B Biology Is a process that fuel your metabolism....
- E English Explain how mentioning Malcom X helps underscore Euchner s point that King was warning people to reject violence....
Ответ:
suspect C is the one who committed the robbery
Explanation:
we all know this because suspect C is the same sample of the probe
Ответ:
On Thursday, Tracy saw the new movie, The Outlaws.