roseemariehunter12
13.12.2020 •
Biology
How do the properties of water help life exist?
Solved
Show answers
More tips
- S Style and Beauty Unbelievable Hairstyles for Long Hair - 2021 Trends...
- H Health and Medicine How to Whiten Teeth and Get the Perfect Smile...
- F Food and Cooking How to Make Thin Pancakes: Recipe and Tips...
- S Style and Beauty Is Hot Scissor Haircutting Beneficial or Dangerous?...
- S Style and Beauty How to Get Rid of Under Eye Bruises?...
- F Food and Cooking Is Bacon Good for You?...
- S Style and Beauty Discover the Art of Nail Design: How Do You Paint Your Nails?...
- P Philosophy How to Develop Extrasensory Abilities?...
- O Other Everything You Need to Know About Kudyabliks...
- C Computers and Internet The Twitter Phenomenon: What it is and How to Use it...
Answers on questions: Biology
- B Biology can someone please help me figure out which letters are the lagging strand, the okazaki fragment, and the enzyme helicase?...
- B Biology A race car travels around a track. It went 20 meters east in 1 second. What was his velocity? A. 0.05 m/s B. 20 m/s east C. 0.05 m/s east D. 20 m/s...
- B Biology Why are the Socotran cormorants attracted to the barren desert landscape...
- B Biology Transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC ...
- B Biology The ability to conduct electricity in the solid state is a characteristic of metallic bonding. this characteristic is best explained by the presence of...
- B Biology The ceremony performed when a child first takes solid food is called grihastha annaprashan upanayana...
- B Biology The ancient remains of plants preserved in the earth in the form of coal, oil, and natural gas are called...
- B Biology Tara has just entered the fetal period. therefore, it has been months since conception....
- B Biology On the third day of a 2-year-old toddler s hospitalization the nurse notes that the child, who had been screaming and crying inconsolably, has begun to regress and is now...
- B Biology A solution that has the same number of molecules as the cell is a ___ solution...
Ответ:
It helps fuel life with things it needs such as oxygen, and helps with the combining of chemicals.
Explanation:
Ответ: