How many amino acids would be included in the polypeptide encoded by the following mrna s'3 a. 7 b. 8 c. 9 d. 10 e. 16

8 amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA 3'

mRNA CODONS:

mRNA is a type of RNA molecule that transmits genetic information stored in the DNA molecule. mRNA sequence, during the process of translation, is read in a group of three nucleotide bases called CODONS. Each codon encodes an amino acid. According to this question, the following mRNA sequence is given: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA 3'. This sequence consists of 48 nucleotide bases. However, translation begins with a start codon with sequence: AUG. In this sequence, translation starts from AUG until it reaches a stop codon (UGA). There are 24 nucleotide bases until this point, hence, 24/3 = 8 amino acids would be included in the polypeptide encoded by the given mRNA.

Learn more at: link

7

Explanation: During translation, several codons have special functions which they serve. AUG is called the initiation codon, it signals the beginning of polypeptide synthesis and also codes for methionine in the internal positions. UAA, UAG and UGA are called termination codons because they do not code for any known amino acid. They signal the end of a polypeptide synthesis.

Each codon is made up of three nucleotides. The number of codons between the initiation codon UAG and the termination codon UGA in the mRNA is seven, thereby encoding seven amino acids.

See the attached diagram for further illustration.

lol

Explanation: