andybiersack154
26.10.2019 •
Biology
Which of the following increases the strength of the hydrophobic interactions in lipid bilayers, and thus makes them less permeable to polar molecules?
a. the presence of double bonds
b. increasing temperature
c. increasing length of the hydrocarbon chains
Solved
Show answers
More tips
- C Computers and Internet The Best Antivirus Programs for your PC...
- H Health and Medicine Angina: Causes, Symptoms, and Treatment...
- C Computers and Internet How to Learn to Type Fast?...
- F Food and Cooking Delight for Gourmets: How to Prepare Liver Pate...
- S Style and Beauty How to braid friendship bracelets?...
- H Health and Medicine Mercury Thermometer Danger: What to do when a thermometer breaks?...
- F Food and Cooking Which Calamari Salad is the Most Delicious?...
- S Society and Politics 10 Tips for Boosting Your Self-Esteem...
- F Food and Cooking The Most Delicious and Simple Fish in Batter Recipe...
- H Health and Medicine What is Autism? Understanding the Basics of This Neurodevelopmental Disorder...
Answers on questions: Biology
- B Biology Explain why biodiversity is important for the survival of species...
- B Biology What description best present the arrangement of continents oceans and landforms according to the theory of tectonic plates?...
- B Biology In cats, long tails are dominant over short tails. Cross one heterozygous long-tailed cat with a short-tailed cat. What is the chance there will be a short-tailed cat born? 75 25 50...
- B Biology What doe the word pattern mean in the pargraphs 5 and 6 of the story...
- B Biology HELP I AM IN A TEST! I WILL MARK AS BRAINLIEST IF CORRECT! Which of the following statements is true? Fusion reactions split hydrogen nuclei apart. Fission reactions release more energy...
- B Biology An ecologist wants to know if diversity in a forest system is likely to decrease when an invasive species is introduced. This invasive species is a fast-growing annual plant that grows...
- B Biology Can someone please help me it’s due today It’s cooking...
- B Biology When energy is changed from one form to another with very little loss, the process is said to be A) efficient B) advantageous C) transformed Or d) excellent...
- B Biology What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?...
- B Biology Many mammals whose diet includes a great deal of leafy plant matter have extra compartments or extensions of their digestive tract that are not present in similar mammals that do not...
Ответ:
Option (C).
Explanation:
The plasma membrane of the eukaryotes are made of the phospholipid bilayer and the proteins are embedded or span the membrane bilayer. The carbohydrates are attached in moieties with the protein and lipid.
The fluidity of the membrane depends on the saturation, cholestrol and the hydrocarbon chains. The hydrocarbon chain is non polar in nature that allows the diffusion of non polar solutes across the membrane. This decreases the permeability of the polar molecules and the hydrophobic interactions in the membrane.
Thus, the correct answer is option (C).
Ответ: