WILL GIVE BRANLIEST !
Case #28104
Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.
Part Two
Copy the DNA sequences for each suspect into a Word document.
Use your special enzyme to cut each sequence at the forward slash marks (/). (You can do this by putting spaces after each slash mark.)
Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).
Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.
Repeat step 1 with the DNA samples for Suspects B and C.
Suspect A
TCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGA
Suspect B
TCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGA
Suspect C
TTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGA
Probe
AGGT
Questions
Answer these following questions in the essay box below.
1. Which suspect most likely committed the robbery?
2. How do you know?
Solved
Show answers
More tips
- C Computers and Internet Отправляем смс через интернет: легко и просто...
- H Health and Medicine Want to Lose Weight? Here s How Many Calories You Need Per Day...
- H Health and Medicine How Many Ribs Do Humans Have?...
- C Computers and Internet Dropbox: What is it and How to Use it...
- F Family and Home Choosing the Right Car Seat for Your Child: Tips and Recommendations...
- C Computers and Internet Е-head: How it Simplifies Life for Users?...
- A Auto and Moto How many blood alcohol level units are allowed in Russian traffic laws?...
- H Horoscopes, Magic, Divination Where Did Tarot Cards Come From?...
- H Health and Medicine How to Deal with Heat Stroke?...
- H Health and Medicine Sunstroke: Causes, Symptoms, and Precautions...
Answers on questions: Biology
- B Biology List the various forms of nitrogen present in the nitrogen cycle...
- B Biology Which of the following would be an accurate title for the table? a. major exports from south africa b. major exports from kenya c. major exports from ivory coast d....
- B Biology What is the long term geological fate of the red sea...
- B Biology Why are scientists who are searching for life on other planets studying archaebacteria? (i already know the answer but this is here because i didn t see it for anyone...
- B Biology Read the information about some diseases. disene type of pathogen that how the pathogen causes disease gets into body diphtheria bacteria through the nose malaria...
- B Biology Ariants/418082/take/6 short answer what is the purpose of a data table when constructing a graph? how did your data table relate to the graph you created? answer using...
- B Biology Autotrophs include all of the following except: algae, plants, cyanobacteria, fungi, euglena...
- B Biology How many major plates do scientists estimate the earth has? how can a plate have both oceanic and continental crust? fast fast fast...
- B Biology 4functions of the connective tissue...
- B Biology Astudent is conducting an experiment to determine how far a ball will roll down a ramp based on the angle of incline. what are the independent and dependent variables...
Ответ:
Answer - Suspect C
Ответ:
I suspect Subject B.
Explanation: It had the closesest to the AGGT probe.
Ответ:
AnswerExplanation:
The nucleolus is a region of the nucleus where ribosomal RNAs are synthesized.
Ribosomes are protein synthesis factories made from the ribosomal RNAs that are synthesized in the nucleolus and ribosomal proteins.
Sometimes, ribosomes are found free in the cytoplasm, other times they are attached to the endoplasmic reticulum, forming the rough endoplasmic reticulum. The rough endoplasmic reticulum is the site of protein synthesis for proteins that are to be secreted from the cell