![Jabari8728](/avatars/37674.jpg)
Jabari8728
26.11.2019 •
Biology
You performed a sanger sequencing reaction and obtained the following electropherogram (a computer-generated trace of the intensity of each color's fluorescence). in this figure, a = green, c = purple, g = black, t = red. the height of the peaks is unimportant. the 5' end of the sequence is at the left of the trace.
what is the sequence of the template dna used for this sequencing reaction?
a.
5' tttgctttgtgagcggataacaa 3'
b.
3' tttgctttgtgagcggataacaa 5'
c.
5' aaacgaaacactcgcctattgtt 3'
d.
5’ ttgttatccgctcacaaagcaaa 3’
e.
3' aaacgaaacactcgcctattgtt 5'
can someone with this? i can never get more than 3/5 right:
match the following terms with their descriptions below.
question selected match
used to detect close or exact complementarity to a probe sequence
c.
high stringency
used in identifying a specific mrna from a mixture
a.
northern blot
used to quantitate the initial template concentration of an unknown relative to a standard template of known concentration
b.
template dna
reliant upon dna mismatch repair
d.
site-directed mutagenesis
refers to the sequence of interest within the sample in a pcr reaction
e.
cycle threshold method (ct)
Solved
Show answers
More tips
- H Health and Medicine Why do our Joints Crack?...
- H Health and Medicine What Makes a Man a Man?...
- C Computers and Internet How to Get Rid of Spam in ICQ?...
- A Art and Culture Who Said The Less We Love a Woman, the More She Likes Us ?...
- F Family and Home How to Get Rid of Your Neighbors?...
- S Society and Politics How Could Nobody Know About the Dead Mountaineers?...
- H Health and Medicine How to Cure Adenoids?...
- H Health and Medicine Why Wearing a Back Brace Can Be Beneficial During Back Strain?...
- S Sport When and Where Will the 2014 World Cup be Held?...
- C Computers and Internet How to Choose a Monitor?...
Answers on questions: Biology
- B Biology 2. A__image is formed in a plane mirror. O virtual O clear...
- B Biology Laying the groundwork for the germ theory of disease discovered that organisms cannot spontaneously arise, but must be introduced into an environment. A. Anthony Van Leeuwenhoek...
- M Mathematics Find the missing value 75 150 (120 60...
- H History Which is the best definition of naturalization? the process of living and working in the u.s. in order to become a citizen the act of taking an oath of loyalty to the u.s....
Ответ:
Ответ:
Stay at his light
Explanation:
It is important that the lighthouse keeper resists the urge to help in the shipwreck and instead stays at his light. This is because ships are likely to continue approaching the shore. If the lighthouse keeper abandons his post, these other ships could suffer from an accident as well due to the lack of guidance in their navigation.