vonyeaparker6064
28.01.2020 •
Business
Kroger sponsors such brands as private selection, heritage farm, and simple truth. kroger does not manufacture any of these products. which type of brand sponsorship is kroger using?
a. a private brandb. a co-brandc. a national brandd. a licensed brande. a manufacturer's brand
Solved
Show answers
More tips
- D Dating, Love, Relationships How to Overcome Jealousy: Tips and Tricks...
- H Health and Medicine Headache: A Comprehensive Guide to Treatment...
- G Goods and services Stock center - a modern way of optimizing logistics...
- F Food and Cooking How to Properly Wash a Down Jacket? Tips from Experts...
- C Computers and Internet Thin Client: What It Is and Why You Need It?...
- F Food and Cooking The Most Delicious and Simple Fish in Batter Recipe...
- F Food and Cooking Red Caviar: How to Choose the Best?...
- C Computers and Internet Clearing Cache: How to Speed Up Your Browser...
- S Style and Beauty How are artificial nails removed?...
- S Style and Beauty Secrets of Tying a Pareo: 5 Ways...
Answers on questions: Business
- B Business Explain why teenagers with jobs may have more discretionary income than their parents. | 27.List and describe 2 services provided by Canadian financial institutions that would be used...
- B Business 13. Oriole Corp. incurred $750,000 of research and development costs to develop a product for which a patent was granted on January 2, 2015. Legal fees and other costs associated with...
- B Business Rather than merely counting media exposures, a better measure of marketing public relations effectiveness is the . A) number of promotional tools required B) effect it has on its market...
- B Business In a small, closed economy national income (GDP) is $600.00 million for the current quarter. Individuals have spent $250.00 million on the consumption of goods and services. They have...
- B Business An election is being held to fill three seats on the board of directors of a firm in which you hold stock. The company has 8,200 shares outstanding. If the election is conducted under...
- B Business The following transactions are for Marin Company. 1. On December 3, Marin Company sold $492,200 of merchandise to Cullumber Co., on account, terms 2/10, n/30. The cost of the merchandise...
- B Business Sheffield Co. had retained earnings of $19900 on the balance sheet but disclosed in the footnotes that $2800 of retained earnings was restricted for building expansion and $800 was...
- B Business Assume that Tree Co. has the ability to discontinue both product lines and rent the factory space previously used for the production of Leaves and Bark. The factory space for Leaves...
- B Business Riley Company borrowed $36,000 on April 1, Year 1 from the Titan Bank. The note issued by Riley carried a one year term and a 7% annual interest rate. Riley earned cash revenue of...
- B Biology DNA: GTACGCGTATACCGACATTC mRNA: Codon: Anitcodon: Amino Acids:...
Ответ: