If the temperature and volume of a gas are held constant, an increase in pressure would most likely be caused by an increase in the number of moles of gas.

true
false
brainliest

Solved

Show answers

Ответ:

MattPong

15.01.2021

Chemistry

Take away 1 electron

0,0(0 оценок)

Ask your question to the AI advisor

Ai-bot is an expert in any field and is the perfect companion for reliable and useful answers and advice on a variety of topics, including science, history, technology, art, sports, health, culture and more.

Ask your question

More tips

S Sport How to Build Arm Muscles? Effective Exercises and Tips...
H Health and Medicine When can it be said that a person has a normal pulse?...
A Art and Culture When Will Eurovision 2011 Take Place?...
S Style and Beauty How to Choose the Perfect Hair Straightener?...
F Family and Home Why Having Pets at Home is Good for Your Health...
H Health and Medicine How to perform artificial respiration?...
H Health and Medicine 10 Tips for Avoiding Vitamin Deficiency...
F Food and Cooking How to Properly Cook Buckwheat?...
F Food and Cooking How Many Grams Are In a Tablespoon?...
L Leisure and Entertainment Carving: History and Techniques for Creating Vegetable and Fruit Decorations...

Answers on questions: Chemistry

C Chemistry 1. Determine molarity 525 g of lead(II) nitrate, Pb(NO3)2, dissolved in 1250 mL of solution...
C Chemistry 4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please...
C Chemistry Is Dr. Ima Stronomer a black hole...
C Chemistry Instead of burning zinc in oxygen to form ZnO and to obtain energy, one can cause the oxidation of zinc in air (oxygen) to occur in an electrochemical cell. In the process, one produces...
C Chemistry The data table below represents the properties determined by the analysis of substances A, B, C, and D. Substance Melting Point (°C) Boiling Point (°C) Conductivity А -80 - 20 none...
C Chemistry How many neutrons are in an atom of mg-25...
C Chemistry Difference between compounds and mixtures. how do you separate them...
M Mathematics 1 / 2 = + 2 = 8 just a little thing to do...
M Mathematics It costs $0.60 to run a fan for 4 hours. How much does it cost to run the fan for 6 hours?...
M Mathematics a windowpane is 8 inches tall and the diagonal distance from one corner to the other is 17 inches. how wide is the windowpane...

Ask an AI advisor a question

I want advice

If the temperature and volume of a gas are held constant, an increase in pressure would most likely be caused by an increase in the number of moles of gas. true false brainliest