![Jasoncookies23](/avatars/21693.jpg)
Jasoncookies23
12.10.2019 •
Chemistry
What is the number of nitrogen atoms in 12g aluminium nitrate, al(no3)3?
Solved
Show answers
More tips
- F Food and Cooking What age is appropriate for giving your child cocoa?...
- A Auto and Moto How to Start a Diesel Engine in Cold Weather?...
- F Family and Home How to Remove Tar Stains: Tips and Recommendations from Experts...
- F Family and Home How to Remove Fading from Clothes: Tips and Tricks...
- S Sport How to Do a Jumping Split...
- H Health and Medicine How Did Inna Lose Weight on Dom 2?...
- F Family and Home How to Properly Fold Napkins in a Napkin Holder?...
- F Food and Cooking How to Set Up Ventrilo - The Ultimate Guide...
- S Science and Technology How to Make a Homemade Smoker: The Ultimate Guide...
- A Auto and Moto Battle for the Relocation of The Cherkizovsky Market: Who Won?...
Answers on questions: Chemistry
- C Chemistry When is a chemical equation balanced?...
- C Chemistry 7. If (H+J of a solution is equal to 1.0 x 10 , the solution...
- C Chemistry 38. What is the shape of the H2S molecule?benttrigonal planarlinearpyramidal...
- C Chemistry How did Mendeleev decide which elements should be placed in the same group of the periodic table?...
- C Chemistry Which of the following is an example of physical change?...
- C Chemistry A 15 % salt (NaCl)solution is made with 750.0 grams of solution. What is the mass of sodium chloride used to make the solution?...
- C Chemistry Lab: Thermal Energy Transfer Assignment: Lab Report Active Instructions Click the links to open the resources below. These resources will help you complete the assignment....
- C Chemistry Is Dr. Ima Stronomer a black hole...
- C Chemistry 4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please...
- C Chemistry Iknow the answer is 355 bc my teacher gave me the answer but i need to show workand i have no idea how to solve it so somebodyyy...
Ответ:
1 N inside
1 x 3 = 3 nitrogen atoms
The molar mass of Al(NO3)3= 212.996 g/mol
nitrogen is 14 g/mol and is 19.7% if the molar mass
19.7% of 12 g = 2.354g
2.354/14 = 0.196 N
Ответ:
c
Explanation:
base are 7 and up and acids are 6 down