![AaronMicrosoft15](/avatars/33667.jpg)
AaronMicrosoft15
03.05.2021 •
Health
Question 5 1 pts All of these are examples of exercises that work your back accept which ones? Push-Ups Bicep Curls Rows Reverse Fly
Solved
Show answers
More tips
- F Food and Cooking Discover the Health Benefits of Cedar Nuts...
- S Science and Technology Exploring Our Galaxy: How Many Planets are in the Milky Way?...
- S Science and Technology Colliders: How They Work and Why They Matter...
- A Animals and plants Unraveling the Mystery of Loch Ness: What Does the Loch Ness Monster Look Like?...
- L Leisure and Entertainment How Many Seasons are There in the TV Show Interns?...
- S Sport Playing Bowling: Rules and Advice for Novices...
- L Leisure and Entertainment The Best Film of 2010: A Look Back at the Academy Awards...
- S Sport How to Learn Swimming? Simple Tips for Beginners...
- C Computers and Internet What is Web 2.0 and How Does it Work?...
- C Computers and Internet War of Social Media: Which Platform is the Leader?...
Answers on questions: Health
- H Health When she first started using cocaine, helena really enjoyed the positive feelings that she got from the highs. after some time of using, however, she found that the lows that she...
- H Health Evelyn dropped ketchup on her pants during lunch. although her teacher was able to remove the stain completely, evelyn cries hysterically, saying that she wants to go home because...
- H Health Which type of foods should generally be avoided several hours before exercise?...
- M Mathematics write an inequality with a solution that matches the graph at least two steps should be needed to solve your inequality. Just 62 and 64 please...
- S Social Studies Hello y all it s midnight already haystshout out to my girl friend...
- M Mathematics Given line AB is parallel to line DE and C is the midpoint of AE. Prove line BC is congruent to line DC...
- H History Why do you think the Cities and Mohejo-Dara developed along the Indus River...
- M Mathematics How are the SAS Postulate and SSS Postulate alike? Check all that apply. A.They both require three congruency statements. B.They both use two sides and one angle. C.They both use...
- B Biology 3.Original DNA sequence: 3 TACCGCTTACGTCTGATCGCT 5 Mutated DNA sequence: 3 5 Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3 TACCGCTTACGTCTGATCGCT...
- B Biology What is the building unit that enters the plant cell organelle membranes? A -fatty acids b -ribose sugar c -simple lipids d -nucleic acids...
Ответ:
I didn't understand the question but if you can explain the question I can help also nive pfp anime ig bakugo ^^
Ответ:
working out at the gym once a year
Explanation:
saw this on a flashcard on quizlet. hope this helps