3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' 5'
Type of mutation (3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' 5'
Type of mutation ( 3pts) :
Amino acid ( 3pts):
Type of mutation ( 3pts):
Solved
Show answers
More tips
- S Sport Running: How to Do It Right?...
- F Food and Cooking How to Cook Spaghetti Right – Secrets and Tips...
- P Philosophy Personal attitude towards Confession: how to prepare and undergo the procedure correctly?...
- H Health and Medicine Flu: How to Recognize It by the First Symptoms?...
- F Food and Cooking How to Sober Up Quickly? Important Facts and Tips...
- H Health and Medicine How to Properly Take a Blood Sugar Test?...
- H Health and Medicine Simple and Effective: How to Get Rid of Cracked Heels...
- O Other How to Choose the Best Answer to Your Question on The Grand Question ?...
- L Leisure and Entertainment History of International Women s Day: When Did the Celebration of March 8th Begin?...
- S Style and Beauty Intimate Haircut: The Reasons, Popularity, and Risks...
Answers on questions: Biology
- W World Languages Fill in the blank with the word or phrase that best completes the sentence Nos cras 1 vocabitur 2 vocabimini 3 vocabuntur 4 vocabimur...
- M Mathematics What is the range of the data below? 60 70 80 90 100 Help!...
- H History Which of the following scientists did NOT experience persecution from the church due to his discoveries and theories? Kepler Copernicus Newton Galileo...
- P Physics a 45 kg girl is bouncing on a trampoline. during a certain interval after she leaves t he surface of the trampoline, her kinetic energy decreases to 220 J from 420 J. how high does...
- M Mathematics What is the range of the function?...
Ответ:
Complementary base pairing
Explanation:
Trust me G
APEX