![jordonlewis](/avatars/843.jpg)
jordonlewis
08.02.2021 •
History
4.idea that government power should be increased through business
laissez-faire
capitalism
communism
mercantilism
Solved
Show answers
More tips
- F Food and Cooking Delight for Gourmets: How to Prepare Liver Pate...
- F Family and Home How to Remove Tar Stains: Tips and Recommendations from Experts...
- F Family and Home How to Remove Fading from Clothes: Tips and Tricks...
- S Sport How to Do a Jumping Split...
- H Health and Medicine How Did Inna Lose Weight on Dom 2?...
- F Family and Home How to Properly Fold Napkins in a Napkin Holder?...
- F Food and Cooking How to Set Up Ventrilo - The Ultimate Guide...
- S Science and Technology How to Make a Homemade Smoker: The Ultimate Guide...
- A Auto and Moto Battle for the Relocation of The Cherkizovsky Market: Who Won?...
- C Computers and Internet How Do You Refill Cartridges?...
Answers on questions: History
- B Biology What is the mRNA in TACCGGATGCCAGATCAAATC?...
- M Mathematics Which equation is correct regarding the measure of 1...
- B Biology In a species of fish, fin shape is controlled by a single gene that has only two alleles. In a generation of 185 fish, the frequency of the recessive allele is 0.25....
Ответ:
Ответ:
I think it's A
Explanation:
Road Transport and the Industrial Revolution (Classroom Activity) At the end of the 17th century, British roads were in a terrible state. A law passed in 1555 instructed local people to maintain the roads in their area. Every parish through which a road passed was legally bound to maintain it by six days a year of unpaid labor.