sugarpiegiselle6915
18.03.2021 •
History
is the best example of a crime against humanity Nazi holdier who eade a campaign to recruit fellow soldiers Nozomer who planned a war strategy to defeat the Allied countries. pemeran who ordered an aggressive attack on another country. karbonal who executed thousands of Jews in a concentration camp. Next Save and Exit
Solved
Show answers
More tips
- S Style and Beauty How to Properly Apply Eye Makeup: Tips from a Professional Makeup Artist...
- A Animals and plants How ants survive winter: exploring the secrets of their winter life...
- F Food and Cooking Discover How to Properly Prepare Dough for Rasstegai...
- P Philosophy Unidentified Flying Object - What is the Nature of this Phenomenon?...
- F Family and Home Protect Your Home or Apartment from Pesky Ants...
- O Other What is a Disk Emulsifier and How Does it Work?...
- F Family and Home What does a newborn need?...
- F Family and Home Choosing the Right Car Seat for Your Child: Tips and Recommendations...
- F Food and Cooking How to Get Reconfirmation of Registration?...
- C Computers and Internet How to Get Rid of Spam in ICQ?...
Answers on questions: History
- G Geography Many scientists are concerned that the ogallala aquifer in the united states is being depleted at an alarming rate. what would most likely be a major effect of this aquifer running...
- M Mathematics Two people are selected at random from a group of 6 pilots and 4 engineers. what is the probability that both of them are engineers?...
- H Health Anybody want to be my Girl friend...
- B Biology Original DNA sequence: 3 TACCGCTTACGTCTGATCGCT 5 Mutated DNA sequence: 3 TACGCGCTTACGTCTGATCGCT 5 Type of mutation ( 3pts): Amino acid ( 3pts): Type of mutation ( 3pts):...
Ответ:
Ответ:
The history of the Holocaust is complex and vast. While The Holocaust Explained is not able to cover every aspect of Holocaust history, it does seek to aid understanding and help learners to navigate through the sequence of events. This timeline aims to take readers through the main events preceding, during, and following the Holocaust. Hopefully i helped
Explanation:
Ответ:
1
Explanation: