Active transport requires energy from the cell. A True
B False
Solved
Show answers
More tips
- F Family and Home Parents or Environment: Who Has the Most Influence on a Child s Upbringing?...
- P Philosophy Unbelievable stories of encounters with otherworldly forces...
- L Leisure and Entertainment How to Choose the Perfect Gift for Men on February 23rd?...
- H Health and Medicine How to Treat Whooping Cough in Children?...
- H Health and Medicine Simple Ways to Lower Cholesterol in the Blood: Tips and Tricks...
- O Other How to Choose the Best Answer to Your Question on The Grand Question ?...
- L Leisure and Entertainment History of International Women s Day: When Did the Celebration of March 8th Begin?...
- S Style and Beauty Intimate Haircut: The Reasons, Popularity, and Risks...
- A Art and Culture When Will Eurovision 2011 Take Place?...
- S Style and Beauty How to Choose the Perfect Hair Straightener?...
Answers on questions: Biology
- B Biology The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from...
- B Biology Explain which student most likely lives in a highly developed country. Describe how one of the four categories of ecological footprint can serve as an environmental indicator...
- H History What specific factors created a climate favorable to the reform efforts of the progressive era?...
- P Physics List some of the characteristics of Terminal Velocity (i.e. what determines an objects Terminal Velocityon Earth?)...
- M Mathematics Need . don t know what these are? ?...
- M Mathematics Use the following figure to answer BOTH parts the question. Describe in words a sequence of transformations that maps ∆ABC to ∆A B C . Write an ordered-pair rule for...
Ответ:
A TRUE
Explanation:
Ответ:
A
Explanation:
active transports moves things against the gradient so it requires energy
passive transport diffuses with the gradient so it doesn't require energy
Ответ:
D. water vapor