cxttiemsp021
18.11.2019 •
Biology
Protein synthesis and mutation cer practice
what is the type of mutation that has occurred in this sequence and its
significance?
original dna sequence: ctgcacctgactcctgaggag
mutated dna sequence: ctgcacctgactcctgggag
claim:
Solved
Show answers
More tips
- F Food and Cooking How to Make Polendwitsa at Home?...
- F Family and Home Parents or Environment: Who Has the Most Influence on a Child s Upbringing?...
- P Philosophy Unbelievable stories of encounters with otherworldly forces...
- L Leisure and Entertainment How to Choose the Perfect Gift for Men on February 23rd?...
- H Health and Medicine How to Treat Whooping Cough in Children?...
- H Health and Medicine Simple Ways to Lower Cholesterol in the Blood: Tips and Tricks...
- O Other How to Choose the Best Answer to Your Question on The Grand Question ?...
- L Leisure and Entertainment History of International Women s Day: When Did the Celebration of March 8th Begin?...
- S Style and Beauty Intimate Haircut: The Reasons, Popularity, and Risks...
- A Art and Culture When Will Eurovision 2011 Take Place?...
Answers on questions: Biology
- B Biology Explain how tidal forces are causing the Moon to slowly recede from Earth...
- B Biology One arctic food chain consists of polar bears, fish, seaweed and seals. Which sequence demonstrates the correct flow of energy between these organisms? demonstrates the correct...
- B Biology Lol I am from india, this is bad, nothing is free! is better...
- B Biology Extinction is the total loss of a species. How might changes in Habitat result in extinction?...
- B Biology What single cell organisms move or feed themselves...
- B Biology Which of the following is the most likely effect of urban sprawl? a. less destruction of natural habitats b. increased shortages of water and other resources c. decreased city...
- B Biology Which best describes the process of making recombinant dna?...
- B Biology Deforestation has no direct impact on reptile species. true or false...
- B Biology What category of organisms can mate and produce fertile offspring...
- P Physics At constant temperature and mole, a sample of helium at 760. torr in a closed container was compressed from 5.00 L to 3.00 L. What was the new pressure exerted by the helium...
Ответ:
c) An embryo and an adult have different genes for hemoglobin. Hope this helps!