naomijefferson22
04.02.2020 •
Biology
What are two concerns of genetically modifying a child?
Solved
Show answers
More tips
- C Computers and Internet IMHO: What is it, why is it important, and how to use it?...
- H Health and Medicine How to Calculate Your Ideal Weight?...
- S Style and Beauty Discover the Art of Nail Design: How Do You Paint Your Nails?...
- P Philosophy How to Develop Extrasensory Abilities?...
- O Other Everything You Need to Know About Kudyabliks...
- C Computers and Internet The Twitter Phenomenon: What it is and How to Use it...
- C Computers and Internet How to Choose a Laptop: Expert Guide and Tips...
- C Computers and Internet How to Choose a Monitor?...
- H Horoscopes, Magic, Divination Where Did Tarot Cards Come From?...
- S Style and Beauty How to Make Your Lips Fuller? Ideas and Tips for Beautiful Lips...
Answers on questions: Biology
- B Biology in Calvin cycle, ATP is used to: to make the 6-Carbon compound formed from CO2 and 5-Carbon sugar a more stable 6-Carbon molecule of glucose/carbohydrate. to make carbon...
- B Biology Changes in weather are caused by the movement and interaction of . What should I fill the blanks in with?...
- B Biology Hi how are you guys? How much water does a human body hold? Also if you don’t want notifications please don’t answer And save me the trouble! Thank you!...
- B Biology Starting with an oocyte that has been released from an ovary, trace the pathway that oocyte would follow before being flushed through the vaginal canal during menstruation...
- B Biology Suppose that you want to compare the kinetic behavior of the two recently discovered peptidase iso-enzymes PepA and PepB. Your initial studies identified a pentapeptide...
- B Biology Mr. and Mrs. Potato Head get married and have “tater tots”. Mr. Potato Head has a horizontal nose and. Mrs. Potato Head has a vertical nose. Most of their offspring...
- B Biology Explain how the administration of the anti tetanus serum prevents tetanus....
- B Biology What happens when the south end of Earth’s axis is tilted toward the Sun? which describes a way that prevailing winds control precipitation totals in a region?...
- B Biology Many mammals whose diet includes a great deal of leafy plant matter have extra compartments or extensions of their digestive tract that are not present in similar mammals...
- B Biology What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?...
Ответ:
Ответ:
ok ur gay
Explanation:
i think ur gay because ur gay