lashaunahard
22.07.2019 •
History
How did competition for land in north america lead to the french and indian war?
Solved
Show answers
More tips
- P Philosophy Unidentified Flying Object - What is the Nature of this Phenomenon?...
- F Family and Home Protect Your Home or Apartment from Pesky Ants...
- O Other What is a Disk Emulsifier and How Does it Work?...
- H Health and Medicine How to Calm Your Nerves? Expert Tips That Actually Work...
- A Animals and plants 5 Tips for Taking Care of Yews to Keep Them Green and Beautiful...
- S Sport How to wrap boxing hand wraps? Everything you need to know!...
- F Food and Cooking 10 Reasons Why You Should Avoid Giving Re-Gifts: An Informative Guide...
- F Family and Home Tender Care for Your Parquet: Is it Possible to Clean Parquet?...
- S Style and Beauty How Are Eyelash Extensions Applied? All Your Questions Answered...
- F Food and Cooking 10 Tips for Proper Sushi Consumption...
Answers on questions: History
- H History President wilson actively campaigned for the creation of the league of nations in 1919. his main purpose was to establish an organization that would allow...
- C Chemistry Match the procedural step to its purpose. a. Prevent ethanol from bumping violently when heated. b. Deprotonate the alcohol to become a good nucleophile. c. Avoid boiling...
- E English Identify the type of phrase and its function in the following sentence. Mini scientist have been researching the possibility of black holes. Phrase: -participle -gerund...
- B Biology What type of adaptation a living thing hide in its enviroment...
- M Mathematics How you get the transform i from A B C D i don t get it...
- B Biology What is the mRNA in TACCGGATGCCAGATCAAATC?...
Ответ:
Ответ:
Explanation:
i am sorry I don't understand your question I wish I could help I'll get my friend to help give me a sec