Thejollyhellhound20
16.04.2020 •
Physics
The graph shows the accumulation of stable atoms during the decay of a radioactive substance. Why does the graph approach the horizontal line y = 100?
Solved
Show answers
More tips
- P Philosophy Unbelievable stories of encounters with otherworldly forces...
- L Leisure and Entertainment How to Choose the Perfect Gift for Men on February 23rd?...
- H Health and Medicine How to Treat Whooping Cough in Children?...
- H Health and Medicine Simple Ways to Lower Cholesterol in the Blood: Tips and Tricks...
- O Other How to Choose the Best Answer to Your Question on The Grand Question ?...
- L Leisure and Entertainment History of International Women s Day: When Did the Celebration of March 8th Begin?...
- S Style and Beauty Intimate Haircut: The Reasons, Popularity, and Risks...
- A Art and Culture When Will Eurovision 2011 Take Place?...
- S Style and Beauty How to Choose the Perfect Hair Straightener?...
- F Family and Home Why Having Pets at Home is Good for Your Health...
Answers on questions: Physics
- P Physics A current of 15 Amps flows through a circuit with a resistance of 0.10 Ohms. What is the voltage? A. 0.006 Volts OB. 1.5 Volts O C. 15 Volts D. 150 Volts...
- P Physics The measure of how much salt will dissolve into 100g of water is . question 29 options: solvent solute solution precipitation solubility...
- P Physics Because the silt (dirt particles) in muddy water eventually settles out, the muddy water is a . question 30 options: solution compound homogeneous mixture suspension colloid...
- M Mathematics Recipe a calls for 4 cups of sugar and makes 48 cookies. recipe b calls for 3 cups of sugar and makes 54 of the same-sized cookies. determine which recipe contains more sugar in each...
- M Mathematics Consider each of the following relationships. which school shows the greatest rate of change between male and female students? in school a, the ratio of male students to female students...
- B Biology Protein synthesis and mutation cer practice what is the type of mutation that has occurred in this sequence and its significance? original dna sequence: ctgcacctgactcctgaggag mutated...
- M Mathematics in the figure, pbx and qby are segments and angle pab = angle qab.prove that pqxy is cyclic....
- G German Ban ghe van phong la mot trong nhung do noi that quan trong o bat ky cong ty nao. nhung mau san pham mang phong cach thiet ke hien dai, sang tao va tien nghi dang tro thanh xu huong...
- E English Read the sentence from “obama’s inaugural address.” what the cynics fail to understand is that the ground has shifted beneath them—that the stale political arguments that have consumed...
- H History Suppose the rrr is 0.15. use the money multiplier formula to determine by how much a $2,000 checking account deposit will increase the money supply....
Ответ:
The decay process started with 100 radioactive atoms.Eventually all 100 atoms will decay to a stable form. The graph approaches 100 because that is the maximum number of stable atoms that can form
Explanation:
Edge
Ответ:
1. Astronomical telescope.
2. Terrestrial telescope.
3. Galilean telescope.
Explanation: