valeriegarcia12
22.04.2021 •
Biology
1 kg of liquid water (specific heat = 4184 J/kg °C) is heated from 0°C to 100°C. What is the change in thermal energy?
Solved
Show answers
More tips
- F Food and Cooking How many stages of coffee roasting are there?...
- G Goods and services Kogda zhdatt Iphone 5? The Latest News and Rumors...
- F Family and Home Parquet or laminate, which is better?...
- L Leisure and Entertainment How to Properly Wind Fishing Line onto a Reel?...
- L Leisure and Entertainment How to Make a Paper Boat in Simple Steps...
- T Travel and tourism Maldives Adventures: What is the Best Season to Visit the Luxurious Beaches?...
- H Health and Medicine Kinesiology: What is it and How Does it Work?...
- O Other How to Choose the Best Answer to Your Question on The Grand Question ?...
- L Leisure and Entertainment History of International Women s Day: When Did the Celebration of March 8th Begin?...
- S Style and Beauty Intimate Haircut: The Reasons, Popularity, and Risks...
Answers on questions: Biology
- B Biology Which of the following is a living factor in the environment?...
- B Biology The greater the amount of weight pressing on an object: the less the amount of pressure. the less the amount of gravity pulling on the object. the greater the amount...
- B Biology Choose three of the following organs. Research the types of cells that make up the organ. Describe in detail the location of the organs and the locations of the...
- B Biology 12. Observe phototaxis“ (the movement of organisms toward light) in the culture of Euglena on the distribution of the organisms, and return the cover to its exact...
- B Biology 5. Why do scientists publish the results of their work? -to verify their results -to get credit for a theory -to form a be hypothesis -to analyze data...
- B Biology Что нужно сделать для повышения устойчивости древесины к вредному воздействиям?...
- B Biology A bird is an organism. Many birds on the same tree are a that tree are a The birds, insects, and squirrels in O community / population O organism / community O...
- B Biology New technologies could improve conditions for all societies. However, priorities are different in different parts of the world. Which is the least important goal...
- B Biology This is because ions move from an area of concentration to an area of concentration....
- B Biology AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of...
Ответ:
Food
Explanation:
Heterotrophs are organisms that obtain energy from other living things. Like sea angels, they take in organic molecules by consuming other organisms, so they are commonly called consumers. Heterotrophs include all animals and fungi as well as many protists and bacteria