![katelynzaro](/avatars/10468.jpg)
katelynzaro
26.01.2020 •
Biology
Ais a natural location where warm or hot water flows up from underground.
a. fault
b. fissure
c. volcano
d. hot spring
Solved
Show answers
More tips
- S Style and Beauty Ultimate Guide on How to Care for Suede Shoes...
- S Sport Running: How to Do It Right?...
- F Food and Cooking How to Cook Spaghetti Right – Secrets and Tips...
- P Philosophy Personal attitude towards Confession: how to prepare and undergo the procedure correctly?...
- H Health and Medicine Flu: How to Recognize It by the First Symptoms?...
- F Food and Cooking How to Sober Up Quickly? Important Facts and Tips...
- H Health and Medicine How to Properly Take a Blood Sugar Test?...
- H Health and Medicine Simple and Effective: How to Get Rid of Cracked Heels...
- O Other How to Choose the Best Answer to Your Question on The Grand Question ?...
- L Leisure and Entertainment History of International Women s Day: When Did the Celebration of March 8th Begin?...
Answers on questions: Biology
- B Biology List all possible alleles with the corresponding percentages for Baby Leprechaun....
- B Biology What properties of water allow water to move up the stem of a plant and overcome gravity?...
- B Biology What is the main advantage of a sole proprietorship?...
- B Biology Consider the following mrna strand: ccauggcaaaggagugacuaa a. what dna sequence would encode for this mrna? provide the sequence in form (single-or doublestranded) in which it...
- B Biology In the video , you learned about the a staph infection . A staph infection is caused by which kind of pathogen / germ ? FungusBacteriaVirusParasite...
- B Biology [TRUE OR FALSE] It has been found that new life can appear from lifeless objects. PLEASE ANSWER ASAP...
- B Biology General term used to refer to the glands that control the expression of secondary sex characteristics in both males and females...
- B Biology Who plays Among Us and Mine craft?...
- B Biology Need help please and thanks...
- B Business Sales $ 920,000 $ 261,000 $ 407,000 $ 252,000 Variable manufacturing and selling expenses 472,000 119,000 194,000 159,000 Contribution margin 448,000 142,000 213,000 93,000...
Ответ: