![Dadchans3779](/avatars/43164.jpg)
Dadchans3779
20.08.2019 •
Biology
What are the functions of the sweat and oil glands
Solved
Show answers
More tips
- C Computers and Internet Porn Banner: What It Is and How to Get Rid Of It?...
- C Computers and Internet Отправляем смс через интернет: легко и просто...
- L Leisure and Entertainment The Best Film of 2010: A Look Back at the Academy Awards...
- H Health and Medicine Simple and Effective: How to Get Rid of Cracked Heels...
- O Other How to Choose the Best Answer to Your Question on The Grand Question ?...
- L Leisure and Entertainment History of International Women s Day: When Did the Celebration of March 8th Begin?...
- S Style and Beauty Intimate Haircut: The Reasons, Popularity, and Risks...
- A Art and Culture When Will Eurovision 2011 Take Place?...
- S Style and Beauty How to Choose the Perfect Hair Straightener?...
- F Family and Home Why Having Pets at Home is Good for Your Health...
Answers on questions: Biology
- B Biology Choose the correct order of classifying organisms in the linnaean system. kingdom- phylum- class- order- family- genus- species . species- order- family- genus-...
- B Biology This is urgent i need asap this is worth 70 points check my answer plz 1. which of the following are biotic factors and which are abiotic factors? rain and grass...
- B Biology Do you think humans will be able to genetically engineer future humans in your life time? do you think humans should be engineering human dna? are there some events...
- B Biology Which of the following boosts electrons to higher energy levels in photosystems I and II after absorbing radiant energy from the sun? A. Water B. ATP C. Chlorophylls...
- B Biology If a species of animals is highly territorial, what dispersion pattern would you expect for that species? The species would likely be vertically distributed in the...
- B Biology Completa las siguientes hebras de ADN 5 ATCGTACGTAGCTACGTAGCT 3 5 GGTATTACGGGCTTAGGCGCCCAA 3 5 AATTCGGGATTCCATTGCTGAC 3...
- B Biology What does the term K represent in the logistic growth model? The death rate for the population The growth rate for the population The carrying capacity for the population...
- B Biology Identify two important factors in collecting and analyzing weather data in the u.s...
- P Physics I need someone to turn these into separate paragraphs! 60 POINTS! The book is applying and exerting force down towards the bookshelf as a result of gravity, while...
- M Mathematics Find the heart rates of you and your friend. do these rates form a proportion? explain. your heartbeats: 22 seconds: 20 you can do 90 sit-ups in 2 minutes. your...
Ответ:
The primary function of oil glands is to protect the skin. These glands by secreting and producing sebum, lubricates hair and skin in the mammals. Huge amount of sebum is helpful in protecting our skin from water and it also assists in controlling the microorganism growth on the skin.
Ответ: