lyndamahe0
27.07.2021 •
Geography
Japan's natural landscapes. Group of answer choices resemble those of populous South Asia: wide alluvial valleys crowded by millions of farmers, plateau country elsewhere being tropical, consist of dense stands of forest and clearings of farmland are mountainous and hilly, with flat land at a premium consist of all the usual landforms except mountains, which rarely occur in the Japanese archipelago delayed Japan's modernization by inhibiting contact and communications with the Asian mainland
Solved
Show answers
More tips
- F Food and Cooking How to Make Shortcrust Pastry: Recipe and Tips...
- H Horoscopes, Magic, Divination Is there a 13th Zodiac Sign?...
- H Health and Medicine Want to Lose Weight? Gain Muscle without Damaging Your Health!...
- F Family and Home Parquet or laminate, which is better?...
- L Leisure and Entertainment How to Properly Wind Fishing Line onto a Reel?...
- L Leisure and Entertainment How to Make a Paper Boat in Simple Steps...
- T Travel and tourism Maldives Adventures: What is the Best Season to Visit the Luxurious Beaches?...
- H Health and Medicine Kinesiology: What is it and How Does it Work?...
- O Other How to Choose the Best Answer to Your Question on The Grand Question ?...
- L Leisure and Entertainment History of International Women s Day: When Did the Celebration of March 8th Begin?...
Answers on questions: Geography
- G Geography How does natural selection produce adaptations in a species...
- G Geography Who traveled to the united states and europe and returned to japan with new ideas...
- M Mathematics Solve for m: m + 13 = 7 A. m = 20 B. m = -6 C. m = -20 D. m = 6...
- M Mathematics Find the values of x and y....
- M Mathematics Hi I need help pls Due in 10 mins...
- M Mathematics PLS HELP WITH THIS LAST QUEASTION ILL MARK BRAINLIEST I DONT NEED STEP BY STEP JUST THE ANSWER ASAP...
- M Mathematics Steve is a part of a Goodwill organization that paints houses for people in need. Each house he paints requires 9 and 3/4 cans of paint. If the organization has 105 and 1/2...
- M Mathematics Fully simplify somebody help me please...
- B Biology What is the exons and the intron in this dna strand? ATCTCTTGCCAGATAGTGTGA TACAGAACGGTCTATCACACT...
- M Mathematics Make V the subject of the formula A=c/2m(v²-u²)...
Ответ:
This question is incomplete because the options have not been correctly separated. Here is the complete, correct question:
Japan's natural landscapes.
A. Resemble those of populous South Asia: wide alluvial valleys crowded by millions of farmers, plateau country elsewhere
B. Being tropical, consist of dense stands of forest and clearings of farmland
C. Are mountainous and hilly, with flat land at a premium
D. Consist of all the usual landforms except mountains, which rarely occur in the Japanese archipelago
E. Delayed Japan's modernization by inhibiting contact and communications with the Asian mainland
The natural landscapes of Japan are mountainous and hilly, with a flat land at premium.
Japan is an island country in East Asia located in the northwestern Pacific Ocean that is made up of an archipelago of more than 6,500 islands.
Japan has a very diverse natural landscape, made up of mountains like Mount Fuji. In addition, it has few flat areas that are grouped in coastal areas where the population density is high. This means the natural landscapes of Japan include both mountains and hills as well flat land.
Learn more at:
Ответ:
A
Explanation:
A mineral has a specific chemical composition and is occurs naturally. Minerals are also defined by having a crystalline structure. Minerals are not, however, directly associated with organic soils since these types of soils are formed largely by the decomposition of organic matter left from biological processes in ecosystems.